PDA

View Full Version : Dwyane Wade DRILLS Darren Collison



Pages : [1] 2

championships
05-16-2012, 12:50 AM
Do you guys think Wade deserves a 1 game suspension or at the very least, Should have been ejected?

To me it looks intentional.
http://www.google.com/url?sa=t&rct=j&q=wades+shove+in+the+back+game+2&source=web&cd=1&ved=0CFAQtwIwAA&url=http%3A%2F%2Fwww.youtube.com%2Fwatch%3Fv%3DNN-JuUpDAXs&ei=JzCzT9rgK-Lo2AWj5fXqCA&usg=AFQjCNFF7SLW-He7LWZbJgzngchVqFWaTw

RonE Coleman
05-16-2012, 12:52 AM
He absolutely should have been ejected... but he's Dwyane wade, I've never seen someone get calls in there favor the way he does

Chill_Will_24
05-16-2012, 12:53 AM
:laugh2: The league would never suspend Wade or Lebron. That would never happen. Wade wold have had to give him a Metta World Peace Special if he wanted to get suspended for a game.

Longhornfan1234
05-16-2012, 12:55 AM
Typical Wade. He's a thug. He should be suspended for the whole second round.

blastmasta26
05-16-2012, 12:55 AM
Yeah, that looks pretty bad.

popo85
05-16-2012, 12:56 AM
Typical Wade. He's a thug. He should be suspended for the whole second round.

He's more of a cry baby diva then a thug

Sactown
05-16-2012, 01:05 AM
I'd definitely love to hear the leagues explanation for not handing out a suspension

cubbies7177
05-16-2012, 01:06 AM
He's more of a cry baby diva then a thug

He's a thug at heart. He's from South Side of Chicago. No doubt, he has thug in him. Miami changed him though.. he seems much more like an angry kid in a sandbox with those fouls. It's always in retaliation. Speak with your game dude... you're good enough. why do you need to do this dumb **** to someone like collison.. just dunk on his ****ing face and run back on defense. there's nothing more that needs to be said or done.

JayHunter
05-16-2012, 01:08 AM
He should have been thrown out and suspended. He's the biggest crybaby in the league. If someone fouled Wade like that they would have definitely been thrown out.

M.Bibby2.0
05-16-2012, 01:09 AM
Kobe, Durant, Rose, CP3, pretty much all superstar gaurds/wings would get away with plays like that, and not get suspended.

AddiX
05-16-2012, 01:10 AM
No surprise, are we forggetting he locked up rondos arm and slammed all his body weight on it last year?

That was as bad a foul as vie ever seen in my life, was clearly intentional.

Sadds The Gr8
05-16-2012, 01:10 AM
shoulda been ejected but they'd never eject Wade because the NBA shows bias towards stars:facepalm:

stawka
05-16-2012, 01:10 AM
Please suspend him for a game. If it happens, Miami WILL win that game wihout him. Sig it if you have to

Odominator
05-16-2012, 01:11 AM
I dont know how that malicious attack was any different than Jason Smith's takedown of Blake Griffin. Most definitely a one game suspension, but we all know Ol' Stearny.....he wont do it to his poster child...

chicagocubsfan
05-16-2012, 01:12 AM
If that would have happened to wade he would have faked getting airlifted to the hospital.

Longhornfan1234
05-16-2012, 01:12 AM
Please suspend him for a game. If it happens, Miami WILL win that game wihout him. Sig it if you have to

:facepalm:


I hate D-Wade, but GTFO!!!! LeBron can't beat the Pacers without Wade and Bosh.

kozelkid
05-16-2012, 01:12 AM
I know Lebatard once mentioned it, but Wade really changed a lot since around year 3. These type of hits by Wade have been fairly frequent going back to the Celtics series in 2010 and 2011. Punk move and SHOULD be suspended, but won't be.

kozelkid
05-16-2012, 01:13 AM
Kobe, Durant, Rose, CP3, pretty much all superstar gaurds/wings would get away with plays like that, and not get suspended.

When has Rose or Durant EVER committed such flagrant fouls? :eyebrow:

Mckphins
05-16-2012, 01:15 AM
He needed to be ejected

chitownbears89
05-16-2012, 01:20 AM
Nvm

Cubs Win
05-16-2012, 01:20 AM
Wade's a *****. If he got hit like that he not only would've been brought off the court on a stretcher, but would've been calling for the other player to be suspended. Should've been ejected and suspended for at least one game, maybe two.

TrueFan420
05-16-2012, 01:21 AM
should be at least an ejection but the nba wouldnt dare

TrueFan420
05-16-2012, 01:22 AM
should be at least an eject but the nba wouldnt dare call a fair game

lavell12
05-16-2012, 01:24 AM
I don't want a suspension b/c I don't want anymore excuses for Lebron.

LGhost
05-16-2012, 01:26 AM
Refs not trying to hear from the powers above

PleaseBeNice
05-16-2012, 01:35 AM
Wade is such a crybaby *****. He did this because he flopped and didn't get a call on the other end. **** Wade

smokeosama
05-16-2012, 01:35 AM
No better than the Smith hit on Blake, which was a Flagrant 2 and 2 games. This should be a 1 gamer in the playoffs, especially since he was allowed to stay in the game. It SHOULD have been a F2 and then the issue would be done.

championships
05-16-2012, 01:35 AM
Kobe, Durant, Rose, CP3, pretty much all superstar gaurds/wings would get away with plays like that, and not get suspended.

Actually a couple years back Kobe got suspended for bringing his elbow down on a defender after he shot.

Gritz
05-16-2012, 01:37 AM
this is how the game is meant to be played

championships
05-16-2012, 01:38 AM
I don't want a suspension b/c I don't want anymore excuses for Lebron.

Too late with Bosh being out.

smiddy012
05-16-2012, 01:41 AM
Kobe, Durant, Rose, CP3, pretty much all superstar gaurds/wings would get away with plays like that, and not get suspended.

What the **** does that prove?


Should have been, at the very least, a technical foul. Good thing Collison caught himself before he hit the floor. Wade's basically a spoiled brat, calling him a thug would be giving him too much credit.

GiantsSwaGG
05-16-2012, 01:41 AM
He's a thug, but the NBA wants the Heat in the finals so I don't expect him to get ejected

ThunderousDemon
05-16-2012, 01:41 AM
Oh my god!!! bush league!!! bush league!!! He should be suspended for the rest of the playoffs, NO he should be banned from the League. Despicable, disgusting. AAAAAAHHHHHHHH!!!! BRHGHDHBGHDBHDB GBOSIHBVYVOISBIGBIBGISBIYFBVIS!!!!!!!!!!!!

:mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad: :mad:


;)

Gritz
05-16-2012, 01:43 AM
:facepalm:


I hate D-Wade, but GTFO!!!! LeBron can't beat the Pacers without Wade and Bosh.

if he can turn the cavs into a 60 win team playing with a bunch of scrubs, why not?

Ch0ZSeN1
05-16-2012, 01:43 AM
If Collison had done this to Wade or Lebron, he would of been ejected or suspended. David Stern cant give them a suspension or even an explanation of why they are not suspended because his mouth is full........ of Lebron and Wade.

meloman1592
05-16-2012, 01:43 AM
For Wade to get suspended, he'll have to take out a shotgun and shoot a hole through someones head. Then, he'll probably get suspended for a quarter or two...if that

championships
05-16-2012, 01:45 AM
If that would have happened to wade he would have faked getting airlifted to the hospital.

At the least he would have pulled a Pierce and would have called for the wheelchair.

Ch0ZSeN1
05-16-2012, 01:47 AM
lmao wade would of fell at the three point line while Collison was attempting to catch up to him

championships
05-16-2012, 01:47 AM
To be real though.

I would be shocked if the league didn't look more into it.. It looks pretty bad, No way in hell was he going for the ball

gatkins11
05-16-2012, 01:49 AM
D. Whistle at his finest. Much worse than what Stackhouse was suspended for back in 2006.

smokeosama
05-16-2012, 01:50 AM
if he can turn the cavs into a 60 win team playing with a bunch of scrubs, why not?

His supporting cast in Cleveland > his supporting cast in Miami (if he is sans Wade and Bosh). That's a no brainer really... Without Wade and Bosh, this team is easily worse than LBJ's Cavs. It's moot though, because Wade will never get suspended for this, despite a history of these kind of plays.

Teeboy1487
05-16-2012, 01:51 AM
Wade is a dirty player. He deserves a suspension no doubt but Stern will not discipline his pets. They can get away with murder on the court.

Fnom11
05-16-2012, 01:51 AM
He's a thug, but the NBA wants the Heat in the finals so I don't expect him to get ejected

You cry way too much about the Heat.

ThunderousDemon
05-16-2012, 01:55 AM
Tyson Chandler gets a flagrant for setting a screen against LeScared of the 4th quarter and Cry Baby Wade gets a flagrant for clearly hitting a guy when he doesn't have possession of the ball. He won't get suspended because Stern still has Wade suckling on his nipple.

soundjunkies2
05-16-2012, 01:55 AM
That's very similar to the play the got Jason Smith suspended earlier in the season. Had Collison played it off like Blake did Wade probably would have gotten tossed from the game. Obviously, there is no way Wade would get suspended but there could be an argument for one.

soundjunkies2
05-16-2012, 01:59 AM
No better than the Smith hit on Blake, which was a Flagrant 2 and 2 games. This should be a 1 gamer in the playoffs, especially since he was allowed to stay in the game. It SHOULD have been a F2 and then the issue would be done.

Oh, someone already mentioned that play but I agree.

D1JM
05-16-2012, 02:01 AM
just shows how much of a punk he is and how much the league protects him. that should of been an easy ejection.

ThunderousDemon
05-16-2012, 02:01 AM
Where's Mike Tirico,"BUSH LEAGUE, BUSH LEEEEEEEEEEEAAAAAAAGGGGGGUUUUUUUEEEEE!!!!!!".

D1JM
05-16-2012, 02:04 AM
Kobe, Durant, Rose, CP3, pretty much all superstar gaurds/wings would get away with plays like that, and not get suspended.

:facepalm:

topdog
05-16-2012, 02:06 AM
Yeah, that's pretty bad. Apparently, Wade wants to be a 2-sport star.

championships
05-16-2012, 02:06 AM
He blind sided him. I guess Collison had to of got hurt for the League to do anything. Good thing he wasn't hurt

JC_
05-16-2012, 02:07 AM
Granger should be suspended for passing the ball to Wade's head and then looking at the refs while pointing to his teammate who just got taken out.

kblo247
05-16-2012, 02:14 AM
Learned it from Posey, who got suspended for it

basketfan4life
05-16-2012, 02:17 AM
Actually a couple years back Kobe got suspended for bringing his elbow down on a defender after he shot.

actually, Kobe got suspended multiple times for much less than this.

As for Wade, he is surely turned in to a dirty player. What he did to rondo, kobe, hamilton and now this ? But this is all the leagues fault. If he got suspended for one of those plays he wouldn't do it now. But if you aren't getting suspended, hell not even ejected, why not continue ?

3ballbomber
05-16-2012, 02:19 AM
I know Lebatard once mentioned it, but Wade really changed a lot since around year 3. These type of hits by Wade have been fairly frequent going back to the Celtics series in 2010 and 2011. Punk move and SHOULD be suspended, but won't be.
Clearly Wade has changed since Lebron has joined the Heat.

Usually lets his play do the revenge but has turned into a real punk since the 'Big 3'. Complaining/whining, flailing & flopping around like a girl. wtf happened 2 this dude.

Raph12
05-16-2012, 02:21 AM
He might get a one-game suspensions, "might" is the key word though, he probably won't... Although he definitely is deserving.

championships
05-16-2012, 02:30 AM
How can he not get a suspension. Would like to hear the leagues reason.

Meaze_Gibson
05-16-2012, 02:37 AM
Collison tried to undercut him on the sly. Got what he deserved.

Htownballa1622
05-16-2012, 02:41 AM
maybe I'm the only one that feels this way but why would he try tackling collision?

granger had the ball and wade was running as it looked like they bumped into each other. it was an obvious foul on wade but a suspension? really?

I'm sorry but thats not a suspension...look at the replay. wade even says "he cut me off."

but of course it'd just be cooler if he got suspended so haters can rejoice right?

YoungOne
05-16-2012, 02:42 AM
am I the only one who thinks that flagrant 1 was the right call ? :confused:

torocan
05-16-2012, 02:46 AM
Pretty borderline between a Flagrant 1 and 2, but they really should have called it a Flagrant 2 then video reviewed it.

It's ridiculous that Chandler got a Flagrant 2 reviewed to a 1 for setting a PICK and Wade gets a Flagrant 1 without any review.

Htownballa1622
05-16-2012, 02:47 AM
http://www.youtube.com/watch?v=NN-JuUpDAXs&feature=related
pause at 15 seconds and you'll see wade is trying to chase down granger as collision runs right in front of him. wade bumps him which is a foul(collision goes flying cuz he's like 185 lbs max)

but the camera angle switches so you only see wade running over darren.

3ballbomber
05-16-2012, 02:51 AM
http://www.youtube.com/watch?v=NN-JuUpDAXs&feature=related
pause at 15 seconds and you'll see wade is trying to chase down granger as collision runs right in front of him. wade bumps him which is a foul(collision goes flying cuz he's like 185 lbs max)

but the camera angle switches so you only see wade running over darren.
on the slow mo replay Wade evidently lowered his shoulder and followed through with his arm. It was intentional.

Htownballa1622
05-16-2012, 02:54 AM
on the slow mo replay Wade evidently lowered his shoulder and followed through with his arm. It was intentional.

BS. i watched it over and over.

he lowered his shoulder? where? looks to me like he was cut off sprinting to chase down granger as collison got in front and he didn't follow through with his arm AT ALL.

try being objective and look at it. Think about them running full speed and a 185 lbs guy getting bumped.

LGhost
05-16-2012, 02:56 AM
BS. i watched it over and over.

he lowered his shoulder? where? looks to me like he was cut off sprinting to chase down granger as collison got in front and he didn't follow through with his arm AT ALL.

try being objective and look at it. Think about them running full speed and a 185 lbs guy getting bumped.

:k:

YoungOne
05-16-2012, 02:57 AM
he pushes him away thats a flagrant 1... not less not more...

bklynny67
05-16-2012, 02:59 AM
Wade's a ****in toolbag

John Walls Era
05-16-2012, 03:01 AM
Flagrant 1 seems about right. COllison didn't sell the hit. Remember Jason Smith on Griffin?

jbeezy
05-16-2012, 03:03 AM
That is ****ing bush league by Wade. He dropped a couple of notches in my book.

Kevj77
05-16-2012, 03:05 AM
That was definitely a flagrant 2 and he should have been ejected there was no play on the ball and contact was excessive.

3ballbomber
05-16-2012, 03:11 AM
BS. i watched it over and over.

he lowered his shoulder? where? looks to me like he was cut off sprinting to chase down granger as collison got in front and he didn't follow through with his arm AT ALL.

try being objective and look at it. Think about them running full speed and a 185 lbs guy getting bumped.
R U watching a Ballet recital or the replay? Wade's shoulder was lowered, intentionally levels Collision and then extends his arm/elbow to push him further. I saw the play live. Thing is this is not the first time Wade has done this after not getting a call/complaining to ref on the other end and then interntionally harms a guy on the next play out of frustration.

TrueFan420
05-16-2012, 03:15 AM
In the slow mo the ref kinda blocks it but if you do it ultra slow mo you can see that the second Granger passes the ball to Collison that Wade lowers his shoulder into Collison

Htownballa1622
05-16-2012, 03:20 AM
R U watching a Ballet recital or the replay? Wade's shoulder was lowered, intentionally levels Collision and then extends his arm/elbow to push him further. I saw the play live. Thing is this is not the first time Wade has done this after not getting a call/complaining to ref on the other end and then interntionally harms a guy on the next play out of frustration.

i watched it over and over again. he intentionally lowers his shoulder?

in that millisecond before the ball was passed wade had time to think of lowering his shoulder. hmmm...

you do realize he was cut off? they are running full speed. NOWHERE did he even extend his arm off of collison.

a strong breeze could knock over collison running fast. you think a 230 pound professional athlete inadvertently running into a sprinting 185 pound pg is bad? imagine if he meant to tackle him.

MickeyMgl
05-16-2012, 03:22 AM
Kobe, Durant, Rose, CP3, pretty much all superstar gaurds/wings would get away with plays like that, and not get suspended.

Are you kidding? Bryant has been suspended multiple times for stuff that happens routinely throughout the league without ANYBODY ELSE getting suspended even once.

Htownballa1622
05-16-2012, 03:22 AM
In the slow mo the ref kinda blocks it but if you do it ultra slow mo you can see that the second Granger passes the ball to Collison that Wade lowers his shoulder into Collison

again. in the ultra slow mo...you think wade was thinking in ultra slow mo?

It was a bang-bang play.

You happen to miss the second before granger passes the ball collision gets directly in the way of wades course to get to granger? He was obviously going for the chase down and then inadvertently ran into Darren. foul-yes.

suspension-no

MJ-BULLS
05-16-2012, 03:30 AM
idk if he is going to be suspended, but the fact of a matter is, if thats any other player that isn't a star, its a automatic suspension. we will see what happens

TrueFan420
05-16-2012, 03:33 AM
again. in the ultra slow mo...you think wade was thinking in ultra slow mo?

It was a bang-bang play.

You happen to miss the second before granger passes the ball collision gets directly in the way of wades course to get to granger? He was obviously going for the chase down and then inadvertently ran into Darren. foul-yes.

suspension-no

no he was thinking that he was gonna take out Collison.

Idk about suspension id need to really think about it and see all the angles that the nba has and we dont but without a doubt he should have been ejected. Ive seen lesser players get ejected for less. However, cause its wade they would never eject him.

TrueFan420
05-16-2012, 03:34 AM
idk if he is going to be suspended, but the fact of a matter is, if thats any other player that isn't a star, its a automatic suspension. we will see what happens

or at the very least an ejection

Htownballa1622
05-16-2012, 03:42 AM
no he was thinking that he was gonna take out Collison.

Idk about suspension id need to really think about it and see all the angles that the nba has and we dont but without a doubt he should have been ejected. Ive seen lesser players get ejected for less. However, cause its wade they would never eject him.

well then we agree to disagree. i watched collison get in wades path as wade was gaining ground on granger then the inadvertent collision happen on collison.

i agree they would never suspend him though, nor should they.

unleashthebeast
05-16-2012, 06:53 AM
well then we agree to disagree. i watched collison get in wades path as wade was gaining ground on granger then the inadvertent collision happen on collison.

i agree they would never suspend him though, nor should they.

To further agree with your point (even though this person would have some bias), Wade at 0:21 to 0:23 in you video looks over to the ref and mouths the words "he cut me off"

Flagrant one is fine, but this is not a flagrant 2 or a suspension.

sciferguy
05-16-2012, 07:13 AM
http://www.youtube.com/watch?v=gLAPJiETLCE

Andre Miller was suspended 1 game for the exact same play, ruining his iron man streak.

Knicks21
05-16-2012, 07:14 AM
To further agree with your point (even though this person would have some bias), Wade at 0:21 to 0:23 in you video looks over to the ref and mouths the words "he cut me off"

Flagrant one is fine, but this is not a flagrant 2 or a suspension.

I have no idea how you gained that, there are a million other things he could of said.

Wade was leading with his shoulder, and no Collison did not cut him off.

http://www.youtube.com/watch?v=NN-JuUpDAXs&feature=player_detailpage#t=40s

Definitely ran into him, on purpose.

Philapsychosis
05-16-2012, 07:21 AM
BS. i watched it over and over.

he lowered his shoulder? where? looks to me like he was cut off sprinting to chase down granger as collison got in front and he didn't follow through with his arm AT ALL.

try being objective and look at it. Think about them running full speed and a 185 lbs guy getting bumped.

Dude, really? I watched this video once and could see him lowering his shoulder. You watched it multiple times and cannot see it. Dafuq wrong with your eyes?

superior
05-16-2012, 07:21 AM
And what would have happened if Collison would have landed the wrong way and suffered a serious injury? Wade deserves a one game suspension at the MINIMUM....with that being said, whats Wade's deal? I don't remeber him being such a punk before Lebron went to Miami....it seems like Wade is trying to be a tough guy all of sudden since Miami got the big 3....I dont remember him doing any of the things he does now (foul on kobe in all-star game, push on collison, push on rip, etc.)

Weezy
05-16-2012, 07:59 AM
He should have been thrown out but this is playoffs it won't happen. No suspension either.

Lol and people defending him....that was obviously deliberate. He was pissed he didn't get call on other end. It was amazing how many times he stopped playing after not getting a call on one end. I'm losing respect for him more and more.

JayW_1023
05-16-2012, 08:02 AM
At least Kobe helped Faried up. Wade complained the officials, even argued the call.

time4change
05-16-2012, 08:07 AM
Actually a couple years back Kobe got suspended for bringing his elbow down on a defender after he shot.
which still blows my mind.

Too late with Bosh being out.

Trust me, they're going to make excuses anyway. With Bosh there or not. Just how TheBron fans are.

sixer04fan
05-16-2012, 08:09 AM
The bottom line is that he should be suspended, but he obviously won't be.

time4change
05-16-2012, 08:11 AM
He's a thug, but the NBA wants the Heat in the finals so I don't expect him to get ejected
True, I watched David Stern give that MVP trophy to TheBron and his expression pretty much gave it away. It's almost like he was losing his breath speaking about the Queen, and then got a stiffy handing it to The Bron.

If Collison had done this to Wade or Lebron, he would of been ejected or suspended. David Stern cant give them a suspension or even an explanation of why they are not suspended because his mouth is full........ of Lebron and Wade.
Stern's still got the DNA crusty on the side of his mouth.

For Wade to get suspended, he'll have to take out a shotgun and shoot a hole through someones head. Then, he'll probably get suspended for a quarter or two...if that

That someone would have to be TheBron as well...

time4change
05-16-2012, 08:16 AM
Clearly Wade has changed since Lebron has joined the Heat.

Usually lets his play do the revenge but has turned into a real punk since the 'Big 3'. Complaining/whining, flailing & flopping around like a girl. wtf happened 2 this dude.
I agree. Wade was easily my favorite star in the making, then all this. Now he constantly acts like a *****...

maybe I'm the only one that feels this way but why would he try tackling collision?

granger had the ball and wade was running as it looked like they bumped into each other. it was an obvious foul on wade but a suspension? really?

I'm sorry but thats not a suspension...look at the replay. wade even says "he cut me off."

but of course it'd just be cooler if he got suspended so haters can rejoice right?

Brah, are you watching this with your eyes closed? LOL :facepalm:

IF you watched it you'd see that Collison was plenty ahead of Wade for Wade to see him. He clearly saw him and made a conscious decision to do what he did. MY god. Let the excuses pour.

Hater gunna hate though right? lol:facepalm:

Weezy
05-16-2012, 08:17 AM
For Wade to get suspended, he'll have to take out a shotgun and shoot a hole through someones head. Then, he'll probably get suspended for a quarter or two...if that

:laugh2: this is hilarious.

time4change
05-16-2012, 08:19 AM
http://www.youtube.com/watch?v=NN-JuUpDAXs&feature=related
pause at 15 seconds and you'll see wade is trying to chase down granger as collision runs right in front of him. wade bumps him which is a foul(collision goes flying cuz he's like 185 lbs max)

but the camera angle switches so you only see wade running over darren.

Collison was in front of Wade? How the hell could it not be intentional lol. He was at least two steps ahead of Wade.

You can watch it as many times as you want apparently you cant see though.

time4change
05-16-2012, 08:24 AM
To further agree with your point (even though this person would have some bias), Wade at 0:21 to 0:23 in you video looks over to the ref and mouths the words "he cut me off"

Flagrant one is fine, but this is not a flagrant 2 or a suspension.

So he wanted to make sure he had a justifiable reason to intentionally extend his elbow and push Collision from behind? :facepalm:

Look, Wade is a chump, but he's not stupid. He's just covering his tracks so he DOESN'T get suspended.

On point though as I watch that video Collison was plenty ahead of Wade, Collision hardly moved, and Wade totally made the decision to put him down.

His elbow fully extends when he shoves him.

king4day
05-16-2012, 08:36 AM
That's close to suspension worthy. Depends how the officials read this. I don't think he will get one and it's because it's Wade but it's a toss up.

RaiderKid318
05-16-2012, 08:39 AM
Most interesting play during that game. Suspension or not that was intentional and of you get see it, it's because your homer googles must still be on.

Holydiver
05-16-2012, 08:41 AM
Wade would never act tough off the court where street fights occur.

He acts tough on a court where refs and players intervene and stop fights from occurring.

deaner
05-16-2012, 09:05 AM
If stern doesn't do anything, wade should except the fact that it's coming back to him.

But I'm coming from the position that I want to see LBJ try and win by himself in Miami and get knocked out this round.

-Kobe24-TJ19-
05-16-2012, 09:07 AM
intentional, so he should be suspended

BALLER R
05-16-2012, 09:08 AM
If it was the other way around Collison would of been ejected.

69centers
05-16-2012, 09:09 AM
Wade could have done the same thing to the ref and he wouldn't be suspended.

Heatcheck
05-16-2012, 09:10 AM
i definitely feel wade should have been ejected. it was obvious he was lashing out because he didnt get the call on the other end as well.

BALLER R
05-16-2012, 09:11 AM
Things like this why I hope the pacers beat the heat. Wade did it because on the previous play the ref didn't call the foul for him. I use to love wade but then he started acting like a little *****.

Hustla23
05-16-2012, 09:12 AM
If Collison would have laid on the floor and pretended to be dying, Wade might have gotten thrown out or suspended.

Too bad Collison isn't a *****.

69centers
05-16-2012, 09:12 AM
Pretty borderline between a Flagrant 1 and 2, but they really should have called it a Flagrant 2 then video reviewed it.

It's ridiculous that Chandler got a Flagrant 2 reviewed to a 1 for setting a PICK and Wade gets a Flagrant 1 without any review.

Yes, and Chandler was making a basketball play (a pick) and Wade wasn't doing anything because Collison didn't have the ball.


That was definitely a flagrant 2 and he should have been ejected there was no play on the ball and contact was excessive.

Exactly, no play on the ball and excessive contact should have been a flagrant 2.

Hustla23
05-16-2012, 09:14 AM
Wade could have done the same thing to the ref and he wouldn't be suspended.
:laugh:

"Hey ref, you cut me off."

"Oh, that's alright Mr. Wade. Here, let me shine your shoes."

nycsports2
05-16-2012, 09:26 AM
wade didnt go soft until bron and posh got there... i think hes just following suite bc him and haslem the only real ****** on the team

DieHardColtsfan
05-16-2012, 09:37 AM
If that would have happened to wade he would have faked getting airlifted to the hospital.

lol

P Styles
05-16-2012, 09:46 AM
Heat fans are unusually quiet in this thread...

For the amount of talent on that team they shouldnt need to be the league's best actors as well.

Their players get away with murder and opposing teams can't even breathe on these guys without foul calls

Makes me laugh when I see Lebron fly to the floor when someone 35+ pounds lighter than him places their forearm on him

khaleesi
05-16-2012, 09:52 AM
No surprise, are we forggetting he locked up rondos arm and slammed all his body weight on it last year?

That was as bad a foul as vie ever seen in my life, was clearly intentional.

Wade has a history of this nonsense.

Remember the RIP Hamilton foul late in the regular season?

Ridiculous.

BKLYNpigeon
05-16-2012, 09:55 AM
That play should have been a Flagrent 2 and ejection. Collison should have rolled on the floor a few times to sell it better, just to stick it to the Heat. Wade should really get a 1 game suspension for that, it was not a basketball play at all.

khaleesi
05-16-2012, 09:56 AM
wade didnt go soft until bron and posh got there... i think hes just following suite bc him and haslem the only real ****** on the team

Wade has always been a dirty, petty player.

The REFs have only fed the beast with the ridiculous touch fouls he gets.

And it will get worse as his skills diminish.

Heatcheck
05-16-2012, 09:56 AM
Yes, and Chandler was making a basketball play (a pick) and Wade wasn't doing anything because Collison didn't have the ball.



Exactly, no play on the ball and excessive contact should have been a flagrant 2.

Yea but chandler is just as guilty, you cant lean into or extend your hands when you set a pick, he just did it the possession before on lebron and got called for it, then he does it again, you know your getting a flagrant on that.

BKLYNpigeon
05-16-2012, 09:56 AM
Whatever, Wade is a Puss. im glad he missed that bunny layup at the end of the game.

khaleesi
05-16-2012, 09:57 AM
Heat fans are unusually quiet in this thread...

Because they are collectively still waiting for Joey Crawford to call a foul on Collison so Wade can go to the line for 2.

uwish1127
05-16-2012, 09:57 AM
superstar treatment.......Lebron gets it a lot too, except Lebron doesn't play anywhere near as dirty as Wade

khaleesi
05-16-2012, 09:58 AM
Wade also thought he was going to get the call on his layup attempt he shorted.

BKLYNpigeon
05-16-2012, 10:00 AM
superstar treatment.......Lebron gets it a lot too, except Lebron doesn't play anywhere near as dirty as Wade

Lebron is too scared that someone might step up to him and get Exposed.

Lebron is Fake Tough.

NBAfan4life
05-16-2012, 10:01 AM
He should miss at least a game. I wonder if it will even be addressed?

BKLYNpigeon
05-16-2012, 10:02 AM
probably not. no one is really talking about it in the Media.

BKLYNpigeon
05-16-2012, 10:03 AM
I HOPE....in Indiana the fans make Lebron and Wade Big Heads with baby hats and pacifiers.

Pierzynski4Prez
05-16-2012, 10:10 AM
Most of the time Wade can keep his cool, but every now and then he does something like this that shows his true colors. If someone dare steal the ball from him or make him turn it over or whatever, he turns into a a childish person who has to get revenge any way possible, usually by shoving a guy down.

Pierzynski4Prez
05-16-2012, 10:12 AM
Wade would never act tough off the court where street fights occur.

He acts tough on a court where refs and players intervene and stop fights from occurring.

Kind of like how he likes to stare down other players only when they are not looking back at Wade.

Abel Ye
05-16-2012, 10:13 AM
lmao The diva didn't get his calls tonight but of course he doesn't get suspended for that.

teddygreen17
05-16-2012, 10:20 AM
It was not a basketball play at all, he should be suspended 1 game...it will not happen though.. He's just lucky dude wasn't hurt.

NY007
05-16-2012, 10:30 AM
Wade is such a punk, can't believe the **** him and Lebron get away with. If someone did that to them they would be suspended the entire series.

Pierzynski4Prez
05-16-2012, 10:43 AM
Notice how they only do it to smaller players as well. Never a big man. Like LBJ knocking over john lucas.

~Iggy~
05-16-2012, 10:57 AM
Notice how they only do it to smaller players as well. Never a big man. Like LBJ knocking over john lucas.

http://www.youtube.com/watch?v=OqjdkIT9jqc

Totally agree. Wade should stop picking on small guys like Kevin Garnett. It's not even fair. Look at the size of poor little Garnett.

Vinylman
05-16-2012, 11:07 AM
http://www.youtube.com/watch?v=OqjdkIT9jqc

Totally agree. Wade should stop picking on small guys like Kevin Garnett. It's not even fair. Look at the size of poor little Garnett.

wow... a sissy shove at the whistle away from the play... after his guy got destroyed on a pick... which was wades fault

we gotta tough guy here :rolleyes:

LMFAO

effen5
05-16-2012, 11:08 AM
Wade needs to stop acting like a little *****. Seriously, I absolutely loved this guy when I met him a few years ago but hes turned into a little whiny *****.

If he doesn't get his calls then he cries and if that doesn't help he pulls **** like this off.

Remember a few weeks ago against Rip where he just elbowed Rip in the chest because Rip frustrated him?

Wade Grow Up.

kozelkid
05-16-2012, 11:19 AM
maybe I'm the only one that feels this way but why would he try tackling collision?

granger had the ball and wade was running as it looked like they bumped into each other. it was an obvious foul on wade but a suspension? really?

I'm sorry but thats not a suspension...look at the replay. wade even says "he cut me off."

but of course it'd just be cooler if he got suspended so haters can rejoice right?

I got a lakefront on Mars to sell you.

THE WALL
05-16-2012, 11:22 AM
son of a *****.

Cubby
05-16-2012, 11:33 AM
Wade wouldn't dare get in an actual fight with KG.

kdspurman
05-16-2012, 11:41 AM
This should warrant a suspension I think, but I can kinda understand that it won't be. If it was the regular season maybe it is.

I do think if that was David West doing that to Wade, I don't think there's any question on whether it's a suspension or not.

*Silver&Black*
05-16-2012, 11:46 AM
If that would have happened to wade he would have faked getting airlifted to the hospital.

this.

I wouldn't have been surprised if Wade actually flopped on this tackle because his head got hit by the ball and then Granger would have been suspended. The NBA is a joke when it comes to star protection.

IndyRealist
05-16-2012, 11:47 AM
maybe I'm the only one that feels this way but why would he try tackling collision?

granger had the ball and wade was running as it looked like they bumped into each other. it was an obvious foul on wade but a suspension? really?

I'm sorry but thats not a suspension...look at the replay. wade even says "he cut me off."

but of course it'd just be cooler if he got suspended so haters can rejoice right?

He wasn't trying for the ball. It's not a basketball play, so that makes it a flagrant. And he tackled Collison because the fast break was started by Collison stripping the ball from Wade, so Wade was getting back at him. It's not that hard to see if you're not blinded by fan loyalty.

D-Leethal
05-16-2012, 11:55 AM
Collison did cut him off. He was going for one of his/LeBrons patented chase down blocks that requires a full burst of speed, Collison found an angle towards the rim and stepped right in front of DWade. Looks worse than it was, I think Wade was legitimately trying to make a basketball play but ran into a much smaller guy full speed.

Cubby
05-16-2012, 11:58 AM
Collison did cut him off. He was going for one of his/LeBrons patented chase down blocks that requires a full burst of speed, Collison found an angle towards the rim and stepped right in front of DWade. Looks worse than it was, I think Wade was legitimately trying to make a basketball play but ran into a much smaller guy full speed.

Yeah especially since he threw out an elbow to level him. Yup, not intentional at all. :rolleyes:

NYY 26 to 7
05-16-2012, 12:01 PM
if this was reversed it would have been a flagrant 2 easily but those calls don't go against the Heat. He was mad he didn't get a call (which was the right call Wade should have gone up strong and he would have got the call) and went and purposly just laid a shoulder into him.

soundjunkies2
05-16-2012, 12:05 PM
Collison did cut him off. He was going for one of his/LeBrons patented chase down blocks that requires a full burst of speed, Collison found an angle towards the rim and stepped right in front of DWade. Looks worse than it was, I think Wade was legitimately trying to make a basketball play but ran into a much smaller guy full speed.

I would have thought that too but on TV they even said Wade even tried confronting collison after the play but Collison walked away.

But again, that might have been because he was expecting one for the hard play.

D-Leethal
05-16-2012, 12:13 PM
Yeah especially since he threw out an elbow to level him. Yup, not intentional at all. :rolleyes:

He gave him a shoulder bump and put a little extra 'umph' into it, most likely because he was frustrated (similar to the Kobe foul in the all star game) but that doesn't make it a dirty play, just like the play on Kobe wasn't a dirty play. Full speed collisions always look bad, I think it started as Wade trying to make a basketball play and ended as a full speed collision with someone whos built like a truck and already pissed off and someone who is skin and bones and weighs about 100 pounds soaking wet.

I do think this play happens AGAINST the Heat its a flagrant 1 at the very least, but thats just how it goes. Hard fouls on Collison are not called the same as hard fouls on the NBA's golden boys.

cubbiefan_est88
05-16-2012, 12:13 PM
Espn protects the stars too, they wont even show it. Effing ridiculous

Pierzynski4Prez
05-16-2012, 12:20 PM
He gave him a shoulder bump and put a little extra 'umph' into it, most likely because he was frustrated (similar to the Kobe foul in the all star game) but that doesn't make it a dirty play, just like the play on Kobe wasn't a dirty play. Full speed collisions always look bad, I think it started as Wade trying to make a basketball play and ended as a full speed collision with someone whos built like a truck and already pissed off and someone who is skin and bones and weighs about 100 pounds soaking wet.

I do think this play happens AGAINST the Heat its a flagrant 1 at the very least, but thats just how it goes. Hard fouls on Collison are not called the same as hard fouls on the NBA's golden boys.

Yet he had to put some extra 'umph' into it. With everything you described in the part I bolded 2nd, how it that not a dirty play then? If he is "shoulder bumping" (if that's what you call it) harder than normal, a person he is much bigger than, and also while they are running down court?

LA_Raiders
05-16-2012, 12:21 PM
shoulda been ejected but they'd never eject Wade because the NBA shows bias towards stars:facepalm:

Agree

basketfan4life
05-16-2012, 12:23 PM
funny thing is, this is not on nba's game video :)

The funniest thing is, HEAT fans actually yelling "refferries suck" during the incident. :) :)

~Iggy~
05-16-2012, 12:26 PM
Notice how they only do it to smaller players as well. Never a big man. Like LBJ knocking over john lucas.


http://www.youtube.com/watch?v=OqjdkIT9jqc

Totally agree. Wade should stop picking on small guys like Kevin Garnett. It's not even fair. Look at the size of poor little Garnett.


wow... a sissy shove at the whistle away from the play... after his guy got destroyed on a pick... which was wades fault

we gotta tough guy here :rolleyes:

LMFAO

What's the point of your reply?

My message was simply there to disprove Pierzynski's statement that Wade only goes after small guys. It was not a answer where I tried to prove that Wade is a "tough guy".

Corndog
05-16-2012, 12:28 PM
It was a flagrant 2, Wade being a crybaby for getting blocked and not having a foul called(for no reason other than making Wade look bad, because it was a clean block)then getting stripped. There was no play on the ball, it hit him in the head, so he clearly had no eye on the ball. It was an excessive shove, but Collison didn't sell it like Wade, it lacked the backflips and flopping commonly seen in professional wrestling. Wade put his weight into the elbow and his intent was to put Collison on the floor.

The other argument is this is the playoffs, and the Heat have already lost Bosh. This team is a very bad team without these three players, and without two of them I would actually not even try to make the choking argument for LeBron, because it would be nearly impossible to even win a game. The NBA is not going to suspend Wade at this point in the playoffs. If Bosh was still there I would say do it. So I can understand why they didn't call a flagrant 2.

But throughout the season, Wade has gotten away with alot. He probably should have flagrant 2 calls during the season against Garnett and definitely Hamilton. The league is protecting him and it's only enabling his behavior, which continues to get worse.

Pierzynski4Prez
05-16-2012, 12:34 PM
What's the point of your reply?

My message was simply there to disprove Pierzynski's statement that Wade only goes after small guys. It was not a answer where I tried to prove that Wade is a "tough guy".

And what does Wade really do there? Run at a guy full speed while he is trotting to the hoop, and then slowly walk in a circle barely even looking at garnett from what I can tell in that video, and not really getting into it until all players are between them?

bowieinspace
05-16-2012, 12:36 PM
Wow. Wades a *****.

~Iggy~
05-16-2012, 12:38 PM
And what does Wade do there, besides run at a guy full speed while he is trotting to the hoop, and then slowly walk in a circle not even looking at garnett from what I can tell in that video?

From what I can see he's walking straight towards Garnett afterwards, but that's besides the point. My only point was to disprove your "they only go after small guys" statement. Take it or leave it.

celtNYpatsHeels
05-16-2012, 12:43 PM
Wade is a dirty player. Hes isnt on the level on some other guys(like Artest for instance) but the plays on Collison, Rip, and Rondo were all dirty plays. I thought that the shove on Rip was the worst one and yet it got blown over and noone talked about it for some reason.

D-Leethal
05-16-2012, 12:44 PM
Yet he had to put some extra 'umph' into it. With everything you described in the part I bolded 2nd, how it that not a dirty play then? If he is "shoulder bumping" (if that's what you call it) harder than normal, a person he is much bigger than, and also while they are running down court?

If thats what we are calling a 'dirty' play nowadays, than I need to watch more hockey.

Thats a hard foul if you ask me. He was likely going for the chase down block or just to prevent him from getting a clean layup with a good hard foul. They collided at full speed and Wade made sure he wasn't getting a shot up after the bump, he was already pissed and put some extra force into it, like any good hard foul. I think we should get more flagrant no-calls in situations like that. Enough of the sissy flagrants and tech's. Let 'em play, let 'em foul hard.

If your saying it sucks that if Wade and Collison reverse roles than Collison gets called for a flagrant, than I agree with you. But I don't think thats a dirty play whatsoever. Its a basketball play, its not a cheap shot. Basketball at full court full speed can get dangerous when there contact.

I think your issue is more with the superstar favoritism than the act of dirty plays or flagrant fouls.

celtNYpatsHeels
05-16-2012, 12:48 PM
DLethal.... who the &*$# watches hockey

ryang
05-16-2012, 12:50 PM
wade hit a little guy and he went flying.. because he is so little it looked worse then it really was.. if not oh well throw him next time..

29$JerZ
05-16-2012, 12:52 PM
Flagrant 1 is a fine call but if that happens to Wade the player gets suspended.
Pretty sad, lose more respect for Wade by the day.

D-Leethal
05-16-2012, 12:58 PM
DLethal.... who the &*$# watches hockey

I don't know **** about hockey and will admit I am a bandwagon jumper and only started watching for the Rangers this year, but damn its pretty ****ing entertaining and really makes you realize how pussified the NBA has become, even if you compare to a sport like Baseball.

Vinylman
05-16-2012, 01:05 PM
What's the point of your reply?

My message was simply there to disprove Pierzynski's statement that Wade only goes after small guys. It was not a answer where I tried to prove that Wade is a "tough guy".

FAIL

If you call that going after a guy i got a skirt for ya

DeyAce
05-16-2012, 01:08 PM
If that would have happened to wade he would have faked getting airlifted to the hospital.

lmao so true

Muttman73
05-16-2012, 01:14 PM
he's a punk just like his big brother MeBron

Chrash Davis
05-16-2012, 01:15 PM
If it happened to Wade, he would also still by laying on the ground trying to sell it to the refs...Hard to respect a guy like Wade even with all his talent

DeyAce
05-16-2012, 01:23 PM
If it happened to Wade he would act like he got hit by a semi truck

nolafan33
05-16-2012, 01:31 PM
That's worse than what Jason Smith did to Blake Griffin and he got a two game suspension.

Should definitely get some type of suspension.

FLWolvesFan
05-16-2012, 01:44 PM
That's worse than what Jason Smith did to Blake Griffin and he got a two game suspension.

Should definitely get some type of suspension.

Great point.

kobemelo
05-16-2012, 02:00 PM
Typical Wade. He's a thug. He should be suspended for the whole second round.

lmao idk bout all this but an ejection last night woulda been the right move

willabeast77
05-16-2012, 02:03 PM
A suspension is far too much, and the right choice was made by not ejecting him from the game. It wasn't that hard of a play and definitely not intentional. This is the playoffs, maybe had this happened in a regular season game, he would have gotten ejected + a suspension.

CTCUBBIES
05-16-2012, 02:37 PM
Wade is lucky McRoberts and Foster aren't in Indy anymore. Those two goons were laying people out left and right in the Bulls series last year.

I think it's not so much that it was a hard foul, it's that if you take it in sequence it was clearly a premeditated attempt at making statement for not getting a call at the other end. That is the danger of a play like this - he wanted to make a statement and did. There is no way this was just coincidence as some people are trying to cling to.

kdspurman
05-16-2012, 02:54 PM
Really not Much different than Jason Smith/Blake Griffin... But that's the league's another example of inconsistency and star treatment tbh.

http://www.youtube.com/watch?feature=player_embedded&v=Td_YqTueocY

nolafan33
05-16-2012, 02:58 PM
Taking out a guy with the ball vs a guy without the ball are two very different things.

We all know Stern loves his stars. It's exactly what's wrong with the league.

If this was Collison taking out Wade he would already be suspended AND it would probably be more than only one game.

kdspurman
05-16-2012, 03:00 PM
Taking out a guy with the ball vs a guy without the ball are two very different things.

We all know Stern loves his stars. It's exactly what's wrong with the league.

If this was Collison taking out Wade he would already be suspended AND it would probably be more than only one game.

Totally agree. gives them a free pass in a sense.

Htownballa1622
05-16-2012, 03:13 PM
If thats what we are calling a 'dirty' play nowadays, than I need to watch more hockey.

Thats a hard foul if you ask me. He was likely going for the chase down block or just to prevent him from getting a clean layup with a good hard foul. They collided at full speed and Wade made sure he wasn't getting a shot up after the bump, he was already pissed and put some extra force into it, like any good hard foul. I think we should get more flagrant no-calls in situations like that. Enough of the sissy flagrants and tech's. Let 'em play, let 'em foul hard.

If your saying it sucks that if Wade and Collison reverse roles than Collison gets called for a flagrant, than I agree with you. But I don't think thats a dirty play whatsoever. Its a basketball play, its not a cheap shot. Basketball at full court full speed can get dangerous when there contact.

I think your issue is more with the superstar favoritism than the act of dirty plays or flagrant fouls.

You aren't a heat fan are you?

I saw the same thing you saw yet I think the speed made it look worse. I don't think wade even intentionally did it but I guess looking at things objectively is frowned upon and its cooler to join the hating parade.

Should have been flagrant one like it was. No suspension.move on.league is soft.

willabeast77
05-16-2012, 03:20 PM
Really not Much different than Jason Smith/Blake Griffin... But that's the league's another example of inconsistency and star treatment tbh.

http://www.youtube.com/watch?feature=player_embedded&v=Td_YqTueocY

No, that isn't very similar. Jason Smith knocked Blake Griffin far harder and it looked intentional. It was also a regular season game so a suspension was expected.

Lakers + Giants
05-16-2012, 03:20 PM
He wont get suspended. His name isn't Artest/World Peace or Bynum and he doesn't play for the lakers, so he wont be getting a suspension. He should though, he clearly saw him. Intentional. Just as bad as the the Smith on Griffin.

nolafan33
05-16-2012, 03:35 PM
No, that isn't very similar. Jason Smith knocked Blake Griffin far harder and it looked intentional. It was also a regular season game so a suspension was expected.

And Wade didn't look intentional? Come on man.

kdspurman
05-16-2012, 03:38 PM
No, that isn't very similar. Jason Smith knocked Blake Griffin far harder and it looked intentional. It was also a regular season game so a suspension was expected.

At least Blake had the ball and Smith stopped him from going up. Collison didn't even have the ball. Are you kidding? lol... Dirty plays should not be judged on whether they're regular season or playoffs. That's just nuts. And Wade's was CLEARLY intentional cause he was frustrated. Not really getting your argument here.

8kobe24
05-16-2012, 03:53 PM
If thats what we are calling a 'dirty' play nowadays, than I need to watch more hockey.

Thats a hard foul if you ask me. He was likely going for the chase down block or just to prevent him from getting a clean layup with a good hard foul. They collided at full speed and Wade made sure he wasn't getting a shot up after the bump, he was already pissed and put some extra force into it, like any good hard foul. I think we should get more flagrant no-calls in situations like that. Enough of the sissy flagrants and tech's. Let 'em play, let 'em foul hard.

If your saying it sucks that if Wade and Collison reverse roles than Collison gets called for a flagrant, than I agree with you. But I don't think thats a dirty play whatsoever. Its a basketball play, its not a cheap shot. Basketball at full court full speed can get dangerous when there contact.

I think your issue is more with the superstar favoritism than the act of dirty plays or flagrant fouls.

Are you effin kidding me? Really? Which part of that play was not dirty? wade basically went out of his way to lower that shoulder and put some extra force in that shove/elbow to the back. And that was a good hard foul? A good basketball play? Doesn't deserve a flagrant foul? What wade did was no different from a sucker punch. I understand he was frustrated, but that doesn't excuse him from what he did. He deserves at least a 2 game suspension for that if the league had some kind of consistency.

HrtHustleNMscle
05-16-2012, 03:57 PM
Should have absolutely been suspended, he pulls this **** whenever he doesn't get the calls he wants, he's a little crybaby *****. Used to like him, but now him and LBJ are my leaset favorite players in the league. Hope they make it to the finals and lose to OKC.

dannyh1469
05-16-2012, 03:58 PM
Kobe, Durant, Rose, CP3, pretty much all superstar gaurds/wings would get away with plays like that, and not get suspended.

Kobe got suspended for hitting someone in the face on an awkward follow through I don't know what your talking about

DR_1
05-16-2012, 04:01 PM
This is not basketball. But hey, that's what Wade does. He's an embarrasment to the league.

EvanTurner
05-16-2012, 04:10 PM
Wade has become a *****. That was clearly a flagrant 2, this is,the same thing dude did to blake griffen and he got ejected and suspended!

D-Leethal
05-16-2012, 04:15 PM
You aren't a heat fan are you?

I saw the same thing you saw yet I think the speed made it look worse. I don't think wade even intentionally did it but I guess looking at things objectively is frowned upon and its cooler to join the hating parade.

Should have been flagrant one like it was. No suspension.move on.league is soft.

I hate the ****ing Heat more than any team in the NBA, this is the only anti-Heat thread where I didn't jump on the bash brigade, but I try to call it like I see it.

If you want to say it should be a flagrant 2 based on the pussified rules and precedents set by the league in similar scenarios, than I can buy that.

If you want to say if the roles were reversed, that Collison likely would been ejected? I can buy that too.

If you want to say its a dirty play and he should be suspended? I don't buy it.

swirl54
05-16-2012, 04:17 PM
Just Wade being Wade. Without all the calls that go his way this guy would just be an above average player. I have never been sold on this man he is dirty and relies heavily on calls going his way.

EvanTurner
05-16-2012, 04:21 PM
what is rondo and big baby doing in,that pic smooching?

Htownballa1622
05-16-2012, 04:22 PM
I hate the ****ing Heat more than any team in the NBA, this is the only anti-Heat thread where I didn't jump on the bash brigade, but I try to call it like I see it.

If you want to say it should be a flagrant 2 based on the pussified rules and precedents set by the league in similar scenarios, than I can buy that.

If you want to say if the roles were reversed, that Collison likely would been ejected? I can buy that too.

If you want to say its a dirty play and he should be suspended? I don't buy it.

Exactly. I'm a Rockets fan yet I saw the same as u. Some ppl go into it with their mind made up. I just have watched it 50 times & i'm not backing off my stance.

It was a flagrant. But not suspension worthy. He was going for the chase Down and collison stepped directly in wades path. I hate that they change the camera angle to the baseline camera.that's what had everyone confused. I saw it on all angles from TNT overdrive.

swirl54
05-16-2012, 04:23 PM
what is rondo and big baby doing in,that pic smooching?

Evan is that really you? If so I sure hope you sent D Rose a get well soon card YA D***

BklynKnicks3
05-16-2012, 04:27 PM
coward move by a coward ofcourse the league doesnt do anything if that was jr smith or shumpert it would be a suspension. I used to respect wade until he let that coward join his team and try to take shortcuts to another ring.

SeoulBeatz
05-16-2012, 04:28 PM
Well I would imagine if any other player did this, they would have been kicked out/ suspended.

But players like Wade can get away with it.

Nothing you can do really, he's a superstar. Superstars get superstar treatment. I witnessed Allen Iverson get it all the time.

49erGiantLaker
05-16-2012, 04:38 PM
^lol. At that sig.

FlashMacker
05-16-2012, 04:54 PM
Actually a couple years back Kobe got suspended for bringing his elbow down on a defender after he shot.

:laugh2: I remember that. It's at the very beginning

http://www.youtube.com/watch?v=i3DZNIpujeo&feature=related

ThunderousDemon
05-16-2012, 04:57 PM
:speechless:

KB-Pau-DH2012
05-16-2012, 05:21 PM
The problem with Wade is that what he did to Collison, he should have been suspended for a game because of what he has done this season.


Incident #1

Broke Kobe's nose in the All-Star game with a non-basketball play, an unnecessary hard foul during the all-star game, the player has already passed him, and he swipes at Kobe.


Incident #2

Shoves Rip Hamilton down to the floor. Hamilton nudges Wade a little during game play, and Wade retaliates with yet another non-basketball play and shoves Rip to the floor.



Incident #3

Non-basketball play on Collison.

Cubby
05-16-2012, 05:31 PM
What a giant crock of **** this league has turned into.

k.smith904
05-16-2012, 05:38 PM
typical for Wade. He acts like a spoiled little child on the floor.

Always playing for the foul, but when it doesn't go his way, he sets out to hurt somebody (if he isn't too busy pleading his nonexistant case as his teammates hustle back on defense).

At least a flagrant was called, he threw Rip Hamilton to the ground with a similar obviousness and got a mere personal.

Bruno
05-16-2012, 05:39 PM
he should have been ejected.

i wouldn't want to see a playoff suspension for the following game, even if merited.

MetroMan
05-16-2012, 05:42 PM
Amare got suspended and most likely cost him and the suns a title.

Wade SPEARS a player half way across the court, then goes to his face and grills him down......and he gets no punishment?WTH the NBA is rigged, I swear watch the refs screw this up for indiana.

k.smith904
05-16-2012, 05:43 PM
Wade knows he isn't gonna get suspended with Bosh out.

basketfan4life
05-16-2012, 05:45 PM
as expected. Wade isn't punished.

http://espn.go.com/nba/playoffs/2012/story/_/id/7938042/2012-nba-playoffs-nba-not-upgrade-dwyane-wade-flagrant-foul

video of the game on the top. Wade flops real hard on that lay up to get a call, after that chalmers flops on the last second 3, then stares at th ref. flopping is in their blood.

GiantsSwaGG
05-16-2012, 05:45 PM
You cry way too much about the Heat.

And you homerism for the Heat is amazing!

effen5
05-16-2012, 05:46 PM
Because its dwade and not amare

PacersForLife
05-16-2012, 05:50 PM
I wouldn't be surprised if Hansbrough or West sends a message to him sometime in this series.

netsgiantsyanks
05-16-2012, 05:51 PM
wade's mad.

KB-Pau-DH2012
05-16-2012, 05:52 PM
I wouldn't be surprised if Hansbrough or West sends a message to him sometime in this series.

Send a message by winning the series, not by stooping down to their level.

khaleesi
05-16-2012, 05:54 PM
Send a message by winning the series, not by stooping down to their level.

Do both.

netsgiantsyanks
05-16-2012, 05:54 PM
I wouldn't be surprised if Hansbrough or West sends a message to him sometime in this series.

wouldn't risk it. if you even touch wade in a malicious manner, it'll be a automatic ejection.

Chronz
05-16-2012, 05:55 PM
Good Q, NBA is showing remorse but what did Amare do again? Didnt he cross the line?

effen5
05-16-2012, 05:55 PM
Dwyane wade - nba's princess

k.smith904
05-16-2012, 05:56 PM
wouldn't risk it. if you even touch wade in a malicious manner, it'll be a automatic ejection.

wade's gonna fall down long before they can get to him.

Bruno
05-16-2012, 05:57 PM
@ Just finished watching PTI.

KB-Pau-DH2012
05-16-2012, 05:57 PM
Suspending Wade with Bosh already out would decrease LeBron's chances of his first chip. NBA doesn't want this.

Shame on you OP! :p

netsgiantsyanks
05-16-2012, 05:58 PM
welcome to life.

Rivera
05-16-2012, 06:01 PM
Amare was on the bench and put 1 foot over the line onto the court ..... thats an automatic 1 game suspension

Dwade trucked collison its a horrible comparison 2 completley different things

But if you compared jason smith trucking blake 2 dwade trucking collison then you would be up to somethin

ChiSportsDaily
05-16-2012, 06:01 PM
Guys that are truly surprised by a change of direction or cut off don't lower a shoulder and run through a guy football style. The automatic human reaction is to pull back. They only use that as an excuse to justify their actions.

That said, props to Collison for not saying anything. And I don't like the Pacers.

MickeyMgl
05-16-2012, 06:02 PM
again. in the ultra slow mo...you think wade was thinking in ultra slow mo?

Same thing they did to make Artest's elbow on Harden look 50 times worse.

8kobe24
05-16-2012, 06:04 PM
Wade knows he isn't gonna get suspended with Bosh out.

Which is why this league has become a damn shame.:pity: Collison got lucky that he didn't hurt his back on that dirty play by wade.

8kobe24
05-16-2012, 06:05 PM
Dwyane wade - nba's princess

I agree with that...but who's the queen?

8kobe24
05-16-2012, 06:07 PM
Because Amare is not on wade's diva level. On top of that, Amare isn't on stern's pet list.

k.smith904
05-16-2012, 06:09 PM
I agree with that...but who's the queen?

http://www.imgegg.com/img/2/941-3.jpg

JC_
05-16-2012, 06:09 PM
For you to compare Amare's suspension to this you most likely weren't watching back then.

Amare got suspended because he took a couple steps onto the court during an altercation which was a huge no no and automatic suspension. Yes it was lame as hell of the NBA but still totally different from the Wade situation.

They didn't even call Wade's a flagrant 2 during the game so that's probably why there's no suspension or anything.

JayAllDay
05-16-2012, 06:12 PM
Kevin Hart plays mroe straight forward basketball than Dwayne Wade

Giraffes Rule
05-16-2012, 06:17 PM
Stat broke a rule that is clearly defined and is an automatic suspension. Wade should be suspended, but the league has wiggle room because what he did is more subjective.

Chronz
05-16-2012, 06:19 PM
Yea the Amare is a bad comp but this was worthy of flagrant 2 IMO, though its completely subjective I dont think Im reaching with that one. It would be crazy to watch Bron play all by himself tho.

king4day
05-16-2012, 06:21 PM
Completely different situations. Much as I'd like to see Wade suspended a game, I don't think he deserves to be.

BSplaya2121
05-16-2012, 06:21 PM
i watched it over and over again. he intentionally lowers his shoulder?

in that millisecond before the ball was passed wade had time to think of lowering his shoulder. hmmm...

you do realize he was cut off? they are running full speed. NOWHERE did he even extend his arm off of collison.

a strong breeze could knock over collison running fast. you think a 230 pound professional athlete inadvertently running into a sprinting 185 pound pg is bad? imagine if he meant to tackle him.

idk i saw landry fields pass a basketball off of lebron's head and it knocked him over like a tractor trailer hit him. so i mean apparently a 2 pound basketball can knock over the best player in the NBA :laugh2::laugh2::laugh2::laugh2:

Ebbs
05-16-2012, 06:22 PM
suspend him and when Lebron averages 50 and lifts them over pacers! BOOM!!!

BSplaya2121
05-16-2012, 06:23 PM
to my old post
http://www.youtube.com/watch?v=lXBKX1d298k

tom04041
05-16-2012, 06:23 PM
I agree that Wade should have been suspended. Posey got suspended for the exact same hit on Hinrich 6 years ago. Stern is a POS.

kdspurman
05-16-2012, 06:38 PM
Question is, why didn't he cause that's similar to what Horry did... Horry got 2 games actually

B'sCeltsPatsSox
05-16-2012, 06:39 PM
Should've been a flagrant one, it really wasn't that hard of a hit tbh:shrug:

JC_
05-16-2012, 06:46 PM
I don't think Wade should be suspended. Collison looked back to see where Wade was and ran infront of him. Wade was running at full speed and that's probably one of the reasons why it was only a flagrant 1. That one camera angle made it look really bad because all it showed was slow mo of Wade making contact with him.

The most epic thing about the play was the pass from Granger that hit Wade in the head and then he looks at the ref while pointing to his teammate who just went flying.

PacersForLife
05-16-2012, 06:48 PM
I don't think Wade should be suspended. Collison looked back to see where Wade was and ran infront of him. Wade was running at full speed and that's probably one of the reasons why it was only a flagrant 1. That one camera angle made it look really bad because all it showed was slow mo of Wade making contact with him.

The most epic thing about the play was the pass from Granger that hit Wade in the head and then he looks at the ref while pointing to his teammate who just went flying.

It was clear that Wade went out of his way to hit Collison....

BlinkManJan02
05-16-2012, 06:48 PM
It really didn't look that bad. I'm a bit biased though, if it was LeBron or some other player I didn't like I would be whining about it for sure haha.

JC_
05-16-2012, 06:51 PM
It was clear that Wade went out of his way to hit Collison....

Really? So if Collison hadn't ran infront of him Wade would have followed him to the edges of the earth to hit him?

PacersForLife
05-16-2012, 06:53 PM
Really? So if Collison hadn't ran infront of him Wade would have followed him to the edges of the earth to hit him?

Not the point.... watch the video again. Wade purposely shoved Collison to the ground then proceeded to stare him down or whatever, pretty weak for him to go after a smaller player...

JC_
05-16-2012, 06:57 PM
Not the point.... watch the video again. Wade purposely shoved Collison to the ground then proceeded to stare him down or whatever, pretty weak for him to go after a smaller player...

Wade was negligent, yes. Once Collison got infront of him he made contact without caring about his safety but it still only happened because Collison was trying get in his way and slow him down. That's why it was only a flagrant 1.

spreadeagle
05-16-2012, 07:01 PM
Big deal, anyone who thinks he should be suspended is soft...and I dont even like the Heat

Beltrans Mole
05-16-2012, 07:07 PM
Wade didn't even go for the ball I mean c'mon. Not even a flagrant foul on the play? D-Wade was ****ing furious because he didn't get his normal call on the other end, and took out his frustration on Collison. I used to be a huge Wade fan but I really can't stand the guy anymore. He complains about everything, flops, and gets the benefit of the doubt more than any player in the NBA...and in the media's eyes the guy can do no wrong I really don't get it.

The goods
05-16-2012, 07:09 PM
:laugh2: The league would never suspend Wade or Lebron. That would never happen. Wade wold have had to give him a Metta World Peace Special if he wanted to get suspended for a game.

This says it all,so he won't even be fined?
That's complete B.S.

M.Bibby2.0
05-16-2012, 07:11 PM
When has Rose or Durant EVER committed such flagrant fouls? :eyebrow:
I wasn't suggesting they all have, I'm saying they would not be suspended a play off game if they did.


Actually a couple years back Kobe got suspended for bringing his elbow down on a defender after he shot.

Not during playoffs


What the **** does that prove?
Should have been, at the very least, a technical foul. Good thing Collison caught himself before he hit the floor. Wade's basically a spoiled brat, calling him a thug would be giving him too much credit.


I'm stating that stars seldom get suspended in playoffs even if they commit dirty plays, not sure what you want me to prove?

I agree with what your saying, I'm not condoning Wade's play I'm just stating that its the sad reality: stars typically won't get suspended for that type of play. Unless the act is on an even bigger star.


:facepalm:

Save your face palm I'm not condoning it nor am I suggesting your precious Rose would do such a thing, I'm simply stating that IF he did he would likely get away with it. Good job comprehending

M.Bibby2.0
05-16-2012, 07:13 PM
Are you kidding? Bryant has been suspended multiple times for stuff that happens routinely throughout the league without ANYBODY ELSE getting suspended even once.

Not in playoffs man, for instance when he bloodied up bibby with an elbow and it was a flat out no-call. Sure Kobe has gotten a few slaps on the wrist during the regular season but he's also gotten away with lots.

The goods
05-16-2012, 07:14 PM
Big deal, anyone who thinks he should be suspended is soft...and I dont even like the Heat

The whole NBA is soft wade and LeBron get thousands of touch fools the NBA needs to be consistent,if that was anybody else they would've been suspended.

M.Bibby2.0
05-16-2012, 07:17 PM
To clarify, because it seems people misunderstood my previous post.

I don't condone what he did, and certainly should have been tossed that game +maybe 1 more game, but I'm saying the sad reality is a lot of star players would get away with those types of plays during playoffs

Rivera
05-16-2012, 07:17 PM
Whats the difference between dwades hip check and jason smith's hip check?

8kobe24
05-16-2012, 07:18 PM
I wouldn't be surprised if Hansbrough or West sends a message to him sometime in this series.

wade would be down for the count before the hit ever came...

JC_
05-16-2012, 07:19 PM
Whats the difference between dwades hip check and jason smith's hip check?

I can't tell if you're being serious or not.

bluefire7002
05-16-2012, 07:20 PM
The whole NBA is soft wade and LeBron get thousands of touch fools the NBA needs to be consistent,if that was anybody else they would've been suspended.

This is also why they are so used to flopping, they know the refs are gonna call those ticky tacks. At the end of the game last night, Wade wasn't really trying to over take his opponent.. He would much rather throw up a crazy shot and flop acting like he got fouled. It was one of the last possessions of the game, but all I could say was "wow really Wade??".

kenzo400
05-16-2012, 07:20 PM
I dont know how that malicious attack was any different than Jason Smith's takedown of Blake Griffin. Most definitely a one game suspension, but we all know Ol' Stearny.....he wont do it to his poster child...

Collison didn't even touch the ball before he was leveled. Wade just knew it was coming towards him. That is the worst type of foul. This definitely deserves a one game suspension.

ayuntalo
05-16-2012, 07:21 PM
wow, wtf..
if Wade isnt suspended by a game atleast, then NBA should not act like they care and just say it up front that they are just after the money and dont give a *****.

Jason Smith was suspended for a weak version of that, and now D wade wasnt even ejected after that hit?
#1 it was not a basketball play
#2 he gave collison a blow on the back while at full speed and about to take off

im really disappointed on the NBA, so much travesty happening. I grew up loving basketball but nowadays i like watching the NFL now rather than this Pseudo-Basketball league

ayuntalo
05-16-2012, 07:25 PM
If the Heat dont win it all this year considering all the considerations they get from the league.......

kblo247
05-16-2012, 07:25 PM
Whats the difference between dwades hip check and jason smith's hip check?

DC has balls, Blake has a vag.

Really the main difference between the hits is Blake pulled a Blake and flopped his *** off and stayed down to make the refs make the call. DC took a dirty *** hit but wouldn't give Wade the satisfaction of staying down like most real men or boxers/football players do, which he was growing up before going to UCLA.

It's like Kobe or Al getting their nose broke. If they would have hit the deck, there would have been flagrants given out. They didn't though with the hit to the face. Harden for instance took an elbow sure, but there are pics of him clearly peaking and Max Kellerman called him out for it, as he purposely watched the refs to make sure it was sold.

DC just no sold it. It doesn't change the fact Wade made a dirty play intentionally by dropping the elbow, like he damn near snapped Rondos arm intentionally, and admittedly broke Kobe's nose intentionally by meaning to hit them. It is what it is, and it should be a game based off the fact Posey got the same thing for doing the same playoff during a playoff game while being part of the Heat, Ron got it for Barea, Raja got it for Kobe, Rondo for the ref, and many more.

The biggest thing that sucks about The suspensions and fines this season and these playoffs is that the announcement takes so long and they seem to wait to game day with this condensed year, or a little over 24 hours before. Just bad on the league offices part

kenzo400
05-16-2012, 07:27 PM
well then we agree to disagree. i watched collison get in wades path as wade was gaining ground on granger then the inadvertent collision happen on collison.

i agree they would never suspend him though, nor should they.

Wade doesn't own the path. Collison was allready ahead of him. The offensive player isn't required to give space to the defensive player so they can properly defend them on the side. Wade extended his shoulder at the end clearly to push him. That's pretty much what does it. It's not the collision but the intentional pushing off once he hit him.

spreadeagle
05-16-2012, 07:29 PM
The guy was fine! he hoped right back up. I really dont see the big deal. Am I the only person who remembers when NBA palyoffs were basically no blood no foul. sure it was a flagrant but thats it

ayuntalo
05-16-2012, 07:34 PM
The guy was fine! he hoped right back up. I really dont see the big deal. Am I the only person who remembers when NBA palyoffs were basically no blood no foul. sure it was a flagrant but thats it

:facepalm: i bet if that was Blake, Lebron, Wade or Dirk it would be a big deal and instant suspension